Review



pcs 201 012 oligonucleotides primers  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC pcs 201 012 oligonucleotides primers
    Pcs 201 012 Oligonucleotides Primers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1917 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs+201+012+oligonucleotides+primers/Primary+Dermal+Fibroblast%3B+Normal%2C+Human%2C+Adult/pm41800619-428-266-264
    Average 99 stars, based on 1917 article reviews
    pcs 201 012 oligonucleotides primers - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Protease Inhibitor:

    Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-dsRNA (J2) ExAlpha Cat# 10010500; RRID: AB_2651015 Anti-dsRNA (K1) ExAlpha Cat# 10020200; RRID: AB_2756865 Anti-p-IRF3 (S386) abcam Cat# ab76493; RRID: AB_1523836 Anti-IRF3 Cell Signaling Technology Cat# 11904; RRID: AB_2722521 Anti-ADAR1 Cell Signaling Technology Cat# 81284; RRID: AB_3068597 Anti-COX IV abcam Cat# ab33985; RRID: AB_879754 Anti-MAVS Cell Signaling Technology Cat# 3993S; RRID: AB_823565 Anti-Lamin A/C abcam Cat# ab108595; RRID: AB_10866185 Anti-TUBB abcam Cat# ab6046; RRID: AB_2210370 Anti-p-PKR (T451) abcam Cat# ab227983 Anti-PKR abcam Cat# ab32506; RRID: AB_777306 Anti-PKR abcam Cat# ab184257; RRID: AB_2916271 Anti-PNPT1 abcam Cat# ab96176; RRID: AB_10680559 Anti-SUV3 Bethyl Cat# A303-055A; RRID: AB_10895443 Anti-β-actin Sigma Cat# A3854; RRID: AB_262011 Anti-GAPDH Cell Signaling Technology Cat# 5174; RRID: AB_10622025 Control IgG antibody Thermo Fisher Scientific Cat# 10500C; RRID: AB_2532981 Goat anti-mouse IgG Alexa Fluor 488 Thermo Fisher Scientific Cat# A11001; RRID: AB_2534069 Goat anti-rabbit IgG Alexa Fluor 555 Thermo Fisher Scientific Cat# A21428; RRID: AB_2535849 Chemicals, peptides, and recombinant proteins IFN-β PBL Assay Science Cat# 11410-2 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 Actinomycin D Sigma Cat# A1410 α-Amanitin Sigma Cat# A2263 IMT1 MedChemExpress Cat# HY-100461 Emricasan Selleckchem Cat# S7775 S63845 Selleckchem Cat# S8383 RNASelect Thermo Fisher Scientific Cat# S32703 Proteinase K Zymo Research Cat# D3001-2-5 RNase T1 Thermo Fisher Scientific Cat# EN0541 ShortCut® RNase III NEB Cat# M0245L RQ1 DNase I Promega Cat# M6101 RNase H NEB Cat# M0297L Triton X-100 Fisher Cat# BP151-100 Goat Serum Sigma Cat# G6767 BSA Sigma Cat# A7030 DAPI Sigma Cat# D9542 D-Sucrose Fisher Cat# BP2001-1 Tris base Fisher Cat# BP152 MOPS Sigma Cat# M3183 EGTA Sigma Cat# E4378 5M NaCl Fisher Cat# AM9759 PMSF Thermo Fisher Scientific Cat# 36978 (Continued on next page) 22 Cell Reports 45, 117026, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij Imaris Oxford Instruments https://imaris.oxinst.com Prism 10.0 GraphPad Software https://www.graphpad.com/features DIA-NN APTILA https://aptila.bio NormalizerDE Willforss et al. 97 https://normalyzerde.immunoprot.lth.se FastQC v0.11.5 Andrews et al. 98 http://www.bioinformatics.babraham.ac. uk/projects/fastqc Fastp v0.20.1 Chen et al. 99 https://github.com/OpenGene/fastp STAR v2.7.3a and v2.7.9a Dobin et al. 100 https://github.com/alexdobin/STAR featureCounts v1.6.4 Liao et al. 101 https://subread.sourceforge.net/ featureCounts.html DESeq2 Love et al. 67 https://github.com/thelovelab/DESeq2 RepeatMasker Smit et al. 102 https://www.repeatmasker.org BEDTools v2.30.0 Quinlan et al. 103 https://bedtools.readthedocs.io/en/latest Cutadapt v4.9 Martin et al. 104 https://cutadapt.readthedocs.io/en/stable SEISMIC-RNA v2.7.9a Allan et al. 52 https://github.com/rouskinlab/seismic-rna BWA 0.7.18-r1243-dirty Li et al. 105 https://github.com/lh3/bwa DaPars v2.1 Li et al. 56 https://github.com/3UTR/DaPars2 24 Cell Reports 45, 117026, March 24, 2026

    RNA Sequencing:

    Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-dsRNA (J2) ExAlpha Cat# 10010500; RRID: AB_2651015 Anti-dsRNA (K1) ExAlpha Cat# 10020200; RRID: AB_2756865 Anti-p-IRF3 (S386) abcam Cat# ab76493; RRID: AB_1523836 Anti-IRF3 Cell Signaling Technology Cat# 11904; RRID: AB_2722521 Anti-ADAR1 Cell Signaling Technology Cat# 81284; RRID: AB_3068597 Anti-COX IV abcam Cat# ab33985; RRID: AB_879754 Anti-MAVS Cell Signaling Technology Cat# 3993S; RRID: AB_823565 Anti-Lamin A/C abcam Cat# ab108595; RRID: AB_10866185 Anti-TUBB abcam Cat# ab6046; RRID: AB_2210370 Anti-p-PKR (T451) abcam Cat# ab227983 Anti-PKR abcam Cat# ab32506; RRID: AB_777306 Anti-PKR abcam Cat# ab184257; RRID: AB_2916271 Anti-PNPT1 abcam Cat# ab96176; RRID: AB_10680559 Anti-SUV3 Bethyl Cat# A303-055A; RRID: AB_10895443 Anti-β-actin Sigma Cat# A3854; RRID: AB_262011 Anti-GAPDH Cell Signaling Technology Cat# 5174; RRID: AB_10622025 Control IgG antibody Thermo Fisher Scientific Cat# 10500C; RRID: AB_2532981 Goat anti-mouse IgG Alexa Fluor 488 Thermo Fisher Scientific Cat# A11001; RRID: AB_2534069 Goat anti-rabbit IgG Alexa Fluor 555 Thermo Fisher Scientific Cat# A21428; RRID: AB_2535849 Chemicals, peptides, and recombinant proteins IFN-β PBL Assay Science Cat# 11410-2 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 Actinomycin D Sigma Cat# A1410 α-Amanitin Sigma Cat# A2263 IMT1 MedChemExpress Cat# HY-100461 Emricasan Selleckchem Cat# S7775 S63845 Selleckchem Cat# S8383 RNASelect Thermo Fisher Scientific Cat# S32703 Proteinase K Zymo Research Cat# D3001-2-5 RNase T1 Thermo Fisher Scientific Cat# EN0541 ShortCut® RNase III NEB Cat# M0245L RQ1 DNase I Promega Cat# M6101 RNase H NEB Cat# M0297L Triton X-100 Fisher Cat# BP151-100 Goat Serum Sigma Cat# G6767 BSA Sigma Cat# A7030 DAPI Sigma Cat# D9542 D-Sucrose Fisher Cat# BP2001-1 Tris base Fisher Cat# BP152 MOPS Sigma Cat# M3183 EGTA Sigma Cat# E4378 5M NaCl Fisher Cat# AM9759 PMSF Thermo Fisher Scientific Cat# 36978 (Continued on next page) 22 Cell Reports 45, 117026, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij Imaris Oxford Instruments https://imaris.oxinst.com Prism 10.0 GraphPad Software https://www.graphpad.com/features DIA-NN APTILA https://aptila.bio NormalizerDE Willforss et al. 97 https://normalyzerde.immunoprot.lth.se FastQC v0.11.5 Andrews et al. 98 http://www.bioinformatics.babraham.ac. uk/projects/fastqc Fastp v0.20.1 Chen et al. 99 https://github.com/OpenGene/fastp STAR v2.7.3a and v2.7.9a Dobin et al. 100 https://github.com/alexdobin/STAR featureCounts v1.6.4 Liao et al. 101 https://subread.sourceforge.net/ featureCounts.html DESeq2 Love et al. 67 https://github.com/thelovelab/DESeq2 RepeatMasker Smit et al. 102 https://www.repeatmasker.org BEDTools v2.30.0 Quinlan et al. 103 https://bedtools.readthedocs.io/en/latest Cutadapt v4.9 Martin et al. 104 https://cutadapt.readthedocs.io/en/stable SEISMIC-RNA v2.7.9a Allan et al. 52 https://github.com/rouskinlab/seismic-rna BWA 0.7.18-r1243-dirty Li et al. 105 https://github.com/lh3/bwa DaPars v2.1 Li et al. 56 https://github.com/3UTR/DaPars2 24 Cell Reports 45, 117026, March 24, 2026

    Sequencing:

    Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-dsRNA (J2) ExAlpha Cat# 10010500; RRID: AB_2651015 Anti-dsRNA (K1) ExAlpha Cat# 10020200; RRID: AB_2756865 Anti-p-IRF3 (S386) abcam Cat# ab76493; RRID: AB_1523836 Anti-IRF3 Cell Signaling Technology Cat# 11904; RRID: AB_2722521 Anti-ADAR1 Cell Signaling Technology Cat# 81284; RRID: AB_3068597 Anti-COX IV abcam Cat# ab33985; RRID: AB_879754 Anti-MAVS Cell Signaling Technology Cat# 3993S; RRID: AB_823565 Anti-Lamin A/C abcam Cat# ab108595; RRID: AB_10866185 Anti-TUBB abcam Cat# ab6046; RRID: AB_2210370 Anti-p-PKR (T451) abcam Cat# ab227983 Anti-PKR abcam Cat# ab32506; RRID: AB_777306 Anti-PKR abcam Cat# ab184257; RRID: AB_2916271 Anti-PNPT1 abcam Cat# ab96176; RRID: AB_10680559 Anti-SUV3 Bethyl Cat# A303-055A; RRID: AB_10895443 Anti-β-actin Sigma Cat# A3854; RRID: AB_262011 Anti-GAPDH Cell Signaling Technology Cat# 5174; RRID: AB_10622025 Control IgG antibody Thermo Fisher Scientific Cat# 10500C; RRID: AB_2532981 Goat anti-mouse IgG Alexa Fluor 488 Thermo Fisher Scientific Cat# A11001; RRID: AB_2534069 Goat anti-rabbit IgG Alexa Fluor 555 Thermo Fisher Scientific Cat# A21428; RRID: AB_2535849 Chemicals, peptides, and recombinant proteins IFN-β PBL Assay Science Cat# 11410-2 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 Actinomycin D Sigma Cat# A1410 α-Amanitin Sigma Cat# A2263 IMT1 MedChemExpress Cat# HY-100461 Emricasan Selleckchem Cat# S7775 S63845 Selleckchem Cat# S8383 RNASelect Thermo Fisher Scientific Cat# S32703 Proteinase K Zymo Research Cat# D3001-2-5 RNase T1 Thermo Fisher Scientific Cat# EN0541 ShortCut® RNase III NEB Cat# M0245L RQ1 DNase I Promega Cat# M6101 RNase H NEB Cat# M0297L Triton X-100 Fisher Cat# BP151-100 Goat Serum Sigma Cat# G6767 BSA Sigma Cat# A7030 DAPI Sigma Cat# D9542 D-Sucrose Fisher Cat# BP2001-1 Tris base Fisher Cat# BP152 MOPS Sigma Cat# M3183 EGTA Sigma Cat# E4378 5M NaCl Fisher Cat# AM9759 PMSF Thermo Fisher Scientific Cat# 36978 (Continued on next page) 22 Cell Reports 45, 117026, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij Imaris Oxford Instruments https://imaris.oxinst.com Prism 10.0 GraphPad Software https://www.graphpad.com/features DIA-NN APTILA https://aptila.bio NormalizerDE Willforss et al. 97 https://normalyzerde.immunoprot.lth.se FastQC v0.11.5 Andrews et al. 98 http://www.bioinformatics.babraham.ac. uk/projects/fastqc Fastp v0.20.1 Chen et al. 99 https://github.com/OpenGene/fastp STAR v2.7.3a and v2.7.9a Dobin et al. 100 https://github.com/alexdobin/STAR featureCounts v1.6.4 Liao et al. 101 https://subread.sourceforge.net/ featureCounts.html DESeq2 Love et al. 67 https://github.com/thelovelab/DESeq2 RepeatMasker Smit et al. 102 https://www.repeatmasker.org BEDTools v2.30.0 Quinlan et al. 103 https://bedtools.readthedocs.io/en/latest Cutadapt v4.9 Martin et al. 104 https://cutadapt.readthedocs.io/en/stable SEISMIC-RNA v2.7.9a Allan et al. 52 https://github.com/rouskinlab/seismic-rna BWA 0.7.18-r1243-dirty Li et al. 105 https://github.com/lh3/bwa DaPars v2.1 Li et al. 56 https://github.com/3UTR/DaPars2 24 Cell Reports 45, 117026, March 24, 2026



    Similar Products

    pcs 201 012 oligonucleotides primers  (ATCC)
    99
    ATCC pcs 201 012 oligonucleotides primers
    Pcs 201 012 Oligonucleotides Primers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs+201+012+oligonucleotides+primers/Primary+Dermal+Fibroblast%3B+Normal%2C+Human%2C+Adult/pm41800619-428-266-264
    Average 99 stars, based on 1 article reviews
    pcs 201 012 oligonucleotides primers - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results